| Home | About the Journal | Browse Archives | Instructions for Authors | Instructions for Reviewers |
pISSN 1226-3907 / eISSN 2288-9027
| [ Article ] | |
| Natural Product Sciences - Vol. 31, No. 2, pp. 111-120 | |
| Abbreviation: Nat. Prod. Sci. | |
| ISSN: 1226-3907 (Print) 2288-9027 (Online) | |
| Print publication date 30 Jun 2025 | |
| Received 13 Mar 2025 Revised 01 May 2025 Accepted 03 Jun 2025 | |
| DOI: https://doi.org/10.20307/nps.2025.31.2.111 | |
| Anti-Mycobacterial Activity of Ocimum Sanctum Essential Oil Against Clonally Diverse Drug Resistant Mycobacterium Tuberculosis Complex | |
Akinduti Paul Akinniyi1, * ; Ajanaku Christiana Oluwatoyin2, 9 ; Ejilude Oluwaseun3 ; Olumuyiwa Emmanuel Olukayode4 ; Ofem Oluchi Gladys1 ; Dada Michael Olugbamila1 ; Mohamed Elhadidy5, 6, 7 ; El-Ashker Maged8
| |
| 1Department of Medical Laboratory Sciences, Babcock University, Ilishan, Nigeria | |
| 2Department of Chemistry, Covenant University, Ota, Nigeria | |
| 3Institute of Human Virology, Abuja, Nigeria | |
| 4Department of Biological Sciences, Bells University of Technology, Ota, Ogun-State, Nigeria | |
| 5Center for Genomics, Helmy Institute for Medical Sciences, Zewail City of Science and Technology, Giza, Egypt | |
| 6Biomedical Sciences Program, University of Science and Technology, Zewail City, Giza, Egypt | |
| 7Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary, Medicine, Mansoura University, Mansoura, Egypt | |
| 8Department of Internal Medicine and Infectious Diseases, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt | |
| 9Department of Physical Sciences (Industrial Chemistry Unit), Landmark University, P.M.B. 1001, Omu-Aran, Kwara, Nigeria | |
| Correspondence to : *Akinduti Paul Akinniyi, Ph.D., Department of Medical Laboratory Sciences, Babcock University, Ilishan, Nigeria Tel: +234-7038450956; akindutip@babcock.edu.ng | |
Pulmonary morbidity caused by the clonally diverse multi-drug resistant Mycobacterium tuberculosis complex (MDR-Mtbc) is alarming due to increasing resistance to available antimicrobials which further exacerbates the disease burden. The constituted chemical compounds (chemotypes) in Ocimum sanctum essential oil (OsEO) were investigated for their antimycobacterial potential against the MDR-Mtbc strains. Isolated Mtbc strains from sputum samples (n = 546) were analysed with the Xpert MTB/RIF and LJ culture-based assay. Drug susceptibility and evaluation for clonal diversity was performed for MDR-Mtbc. Extracted oil was profiled with GC-MS, and analysed for antimycobacterial activity. Among the confirmed Mtbc cases (n = 546), adults (61.3%) were the most affected and more than 50% of Mtb strains were resistant to rifampicin and isoniazid. Among the isolates, MDR (40.2%) and pre-XDR (2%) strains were observed. OsEO showed growth reduction (48.90GU) and higher inhibitory activity at IC50 against MDR MTbc compared to Bedaquiline. Estimated phytochemical compounds were significantly associated with OsEO anti-Mtb activity (eta = 0.5245; p = 0.002). Estimated cyclohexane, carbonic acid and mercaptoethanol were significantly associated with anti-Mtb activity (PC = 84.5%). Cyclohexane, carbonic acid and mercaptoethanol in OsEO are promising antimycobacterial candidates against clonally diverse MDR-Mtbc, and could be exploited as analogues or derivatives for existing drugs.
| Keywords: Anti-mycobacterial, Ocimum sanctum essential oil, MR-Mtb, Chemotypes |
|
Multidrug-resistant tuberculosis (MDR-TB) caused by the Mycobacterium tuberculosis complex, represents one of the global public health problems and is considered to be a significant threat to infection control and elimination, especially in low-income settings.1,2 Multidrug-resistant Mycobacterium tuberculosis complex (MDR-Mtbc) infection is one of the leading causes of death from single infectious agents with high severity, morbidity, and mortality rates.3 Globally, more than 10 million people are estimated to have active TB with about 1.4 million death,4,5 with Africa estimated for 25% global cases and Nigeria reported to be the sixth country with the highest TB incidence worldwide.6,7 Age demographics of the population aged 15–69 years showed the highest rates of disability-adjusted life years (DALYs) is ascribed to MDR-Mtbc infection, while disproportionate TB surveillance data in different age groups further complicated the burden of infection.8 The increasing emergence of MDR-Mtbc strains in the population that responds to either or both of the first-line drugs (rifampicin and isoniazid) continues to complicate eradication and treatment TB.8-10
The genetic diversity of MDR-Mtbc bacilli has improved molecular epidemiological surveillance, with a focus on TB transmission patterns, population structures of spreading strains and identification of genetic markers. An insight into clonally distinct MDR-Mtbc dissemination through 16S genotyping provides a key guide towards enhancing preventive strategies against the spread in different communities.
In spite of the available preventive, treatment, and control measures, the adverse impacts of MDR-Mtbc remain alarming due to increasing resistance to available antimicrobials, which further exacerbate the disease burden.12-14 There is an urgent need to search for novel drug molecules from plant sources with potent antimycobacterial properties. Of such medicinal plants are Ocimum sanctum, which was previously reported for biological functionalities.15 The antimicrobial properties of the plant phytochemicals serve as a good source for effective lead compounds as antimycobacterial drug candidates. Essential oils from Ocimum sanctum play an important role as antimicrobial agents and have shown ethnobotanical relevance based on their antimicrobial properties.16 The reported antibacterial activity of different chemical compounds (chemotypes) in Ocimum sanctum essential oil (OsEO) was attributed to various mechanisms of action, particularly targeting structures in bacterial cytosol.17,18 Identification and characterization of the OsEO chemotypes with antimycobacterial activity from natural sources is readily available as natural alternative and biologically active plant products compared to chemically derived antimycobacterial agents with high levels of metabolic adverse effects.11 The purpose of this study was to investigate the antimycobacterial potential of OseEO and to identify chemical compositions (chemotypes) with significant antibacterial efficacy.
Ethics approvals – The required approval for the collection of sputum samples with respective metadata from the patients, excluding their personal data, was obtained from the Covenant Health Research Committees, Covenant University, Ota, Nigeria (CHREC/055/2022) and Federal Medical Centre, Abeokuta (FMCA/470/HREC/02/2022). All the necessary written informed consents from the patients with their personal data were kept confidential.
Sample collections – Non-repetitive sputum samples of 546 were collected from clinically diagnosed MTB patients enrolled at the outpatient clinic of the Federal Medical Centre, Abeokuta, between February 2021 and June 2022. This referral health facility provides treatment for respiratory and chest infections for patients from DR-TB Treatment Centers and 13 Primary Health Care facilities located in the nearest urban and rural communities in Southwest Nigeria. Individuals with extra-pulmonary tuberculosis were excluded from the study.
Xpert MTB/RIF assay and drug susceptibility testing – Suspected TB sputum samples were analysed for Mycobacterium tuberculosis complex (MTBC) and Rifampicin (rif) drug resistance carriage using GeneXpert (Cepheid Inc., USA). Briefly, collected sputum samples were diluted in a 2:1 v/v ratio with the GeneXpert Mtb/rif sample reagent and transferred to a GeneXpert cartridge containing the required reagent for nucleic acid amplification for the detection of MTB complex DNA and the rpoB gene associated with rifampicin resistance.20,21 To exclude false reports, positive Xpert MTB/RIF samples were further confirmed with LJ culture. The susceptibility of the identified Mtb/rif isolates was determined using anti-mycobacterial drugs including isoniazid, rifampicin, ethambutol, ofloxacin, kanamycin, amikacin, capreomycin, and protionamide in BACTEC MGIT 960 system.22 LJ-culture positive cultures were allowed to thaw, and 100 µL aliquot suspensions were sub-cultured in labelled MGIT tubes with constituted antibiotics. Stock antibiotics in lyophilized form were prepared and reconstituted into final concentrations of rifampicin (rif) 1.0 µg/mL, isoniazid (inh) 0.1 µg/mL, ethambutol (eth) 5.0 µg/mL, amikacin (amk) 1.0 µg/mL, capreomycin (cap) 2.5 µg/mL, kanamycin (kan) 2.5 µg/mL, ofloxacin (ofx) 2.0 µg/mL, and protionamide (proth) 2.5 µg/mL as previously described.20 Control tubes containing growth control solution of 0.5 mL were included and identified as drug-free MGIT, while other tubes containing drugs were labelled S, I, R, and E. The results were interpreted and recorded at a minimum of 400 growth unit (GU) with all the DST sets, and Mycobacterium tuberculosis H37Rv strain that serves as quality control for test batch of MGIT medium, SIRE, and PZA kits.23
Genotyping MDR MTB and phylogenetic analysis – MDR-Mtb strains were selected based on drug-resistant patterns and their occurrence in all age groups for clonal diversity. Quick-DNA™ Miniprep Plus Kit was used to isolate genomic DNA from each colony already sub-cultured in BACTEC MGIT broth for 2 weeks at 37°C and checked for quality and purity using NanoDrop ND-1000 (NanoDrop Products, Thermo Scientific). The 16S target region of the extracted DNA was amplified using a OneTaq Quick-Load 2x Mastermix containing primers 16S-27F (AGAGTTTGATCMTGGCTCAG) and 16S-1492R (CGGTTACCTTGTTACGACTT) in a volume of 20 µL. After initialization at 4°C, the assay was carried out in amplification reactions for 26 cycles involving 97°C for 60 seconds denaturation, annealing at 50°C for 60 seconds, and elongation at 72°C for 3 minutes. The obtained DNA amplicons were subjected to gel electrophoresis, cleaned with EXOSAP, and was sequenced both forward and reverse directions using a Nimagen Brilliant Dye Terminator cycle sequencer based on the Sanger sequencing protocol.24 The clonal diversity of the strains was analysed with the retrieved sequence data of global strains (Table S1) that were more than 95% homologous from BLAST search and were aligned with the MegAlign package (DNASTAR). The diversity of the strains was evaluated with MEGA software version 625 to create a phylogenetic tree using the Maximum Likelihood to assess the genetic relatedness of the isolates.26 The bootstrap percentages were calculated for every node in PAUP 3.1.1, with 1000 replicates of heuristic search.
Plant selection and phytochemical profiling – Ocimum sanctum leaves are selected based on the previous ethnopharmacological studies for the in vitro activity against drug-resistant Mtbc27 as described in Table S2. Freshly collected leaves of Ocimum sanctum plant from a single population were collected from the Covenant University, Ota, Nigeria, in March 2023 according to the authority of the Floral management. The plant identification and authentication were carried out by Dr. A.S Oyelakin and vouchers were deposited at the Herbarium of the Federal University of Agriculture, Abeokuta, Nigeria (voucher number: FHA-4556). Ocimum sanctum leaves of 120 grams was allowed to air-dry, blended into powdery form, and dissolved in sterile water. The aqueous extract obtained after filtration was hydro-distilled in 400 ml distilled water in a Clevenger-type apparatus for a period of 6 hours and further separated to obtain the essential oil.28 Quantitative phytochemical analysis was performed to estimate most commonly constituted secondary metabolites based on phytochemical compounds subclasses. These compounds include alkaloid, flavonoids, terpenoids, and phenols as described by Soladoye and Chukwuma29 with moderate modifications.
Determination of flavonoids – To determine the flavonoid content, the aluminium chloride colorimetric method was employed. One mL of each plant extract was mixed with 3 mL of methanol, 0.2 mL of 10 % aluminium chloride, 0.2 mL of 1M potassium acetate, and 5.6 mL of distilled water. The entire mixture was allowed to stand at room temperature for 30 min, while the absorbance was measured at 420 nm. The total flavonoid content in each plant part was expressed in terms of standardized quercetin equivalent (mg/g of each extracted compound).
Determination of alkaloids – Five milliltres of the oil was placed in a 250 mL beaker. Two hundred ml of 20% acetic acid was added and then covered to stand for 4 h. Filtration was done, and concentration of the extracted content to one quarter of original volume was applied using a water bath. Drop-wise addition of concentrated ammonium hydroxide to the extract followed until the precipitate was complete. The entire solution was allowed to settle and collection of the precipitate was done by filtration and then weighed.
Determination of terpenoids: The essential oil dissolved in 2 mL of chloroform and evaporated to dryness. Two ml of concentrated H2SO4 was then added to it and heated for 2 minutes. A greyish colour indicated the presence of terpenoids. All tests were carried out in triplicate for each plant part, and the results are presented as Mean ± SD. However, the contents were estimated and expressed in mg/g.
Quantification of total content of phenolic compounds – The phenolic compounds concentration in the oil was determined using the Spectrophotometry method. Folin-Ciocalteu method was used for the quantification of total phenolic content. The reaction mixture contains 1 mL of oil and 9 mL of DMSO. 1 mL of Folin-Ciocalteu phenol reagent was treated with the mixture and well shaken. After 5 minutes, 10 mL of 7% Na2CO3 solution was treated with the mixture. The volume was 25 mL. A set of gallic acid standard solutions (20, 40, 40, 60, 80 and 100 μg/mL) was prepared as earlier. Incubated for 90 min at 30°C and absorbance was analyzed for test and standard solutions with reagent blank at 550 nm with using UV spectrophotometer. The content of total phenolic compound was denoted as mg of GAE/gm of extract.
GC–MS analysis of OsEO – The GC-MS analysis of the essential oil of occimum sancturm was performed with gas chromatography-mass spectrometry, of specifications Thermo Trace 1300GC (THERMO Scientific Corp., USA), coupled with Thermo TSQ 800 Triple Quadrupole MS. The GC-MS system was equipped with a TG-5MS column (30 m×0.25 mm i.d., 0.25 μm film thickness). The analyses were carried out using helium as carrier gas at a flow rate of 1.0 mL/min and a split ratio of 1:10 using the temperature program of 60°C for 1 min; rising at 3.0°C/min to 240°C and held for 1 min. Both the injector and detector were held at 240°C. The diluted samples (1:10 hexane, v/v) of 0.2 μL of the mixtures were injected and mass spectra were obtained with electron ionization (EI) at 70 eV, using a spectral range of m/z 40–450. Most of the metabolites were identified using the analytical method based on mass and time using XCalibur 2.2SP1 and Foundation 2.0SP1. The identification of metabolites was achieved through a comparative analysis of retention time and mass spectra, with standards from the NIST 2.0 Mass Spectral Library.31
Plant antimycobacterial activity – Following the basic standard procedure, the antimycobacteria assay was conducted in Biosafety Class 3. A 15-mL BD BBL MGIT PANTA growth supplement already added to the BD BBL MGIT PANTA antibiotic mixture and mixed well. To form a batch of 5 tubes, the growth supplement/PANTA antibiotic mixture of 800 µL was added to each BD BBL MGIT tube and before the mycobacteria inoculation into the tubes. 5 BD BBL MGIT tubes were used for each clinical isolate and H37Rv in a row of experiments to serve as replicates. The first tube serves as positive growth control for each specimen, and 12 mL, 6 mL, 3 mL, and 1.5 mL of OsEO were added to the other 4 tubes in different batches, and Bedaquiline to another batch. Clinical isolates of Mycobacterium tuberculosis (n = 13) and control strains (H37Rv and Mycobacterium tuberculosis ATCC 27294) were grown in separate prepared liquid broth of the BD BBL MGIT Mycobacterium Growth Indicator tube, and 1 mL of Mycobacterial broth in the MGIT tube was added to 4 mL of sterile saline, vortexed and 500 µL was added to each tube containing different volumes of OsEO. From the 4 mL saline tube, 100 uL was removed and mixed with sterile saline of 10 mL in another tube. A 500 uL from this tube was added to the growth control tube. All tubes were capped tightly and well mixed. For H37Rv and each mycobacterial isolate, the experiment was performed in replicates. All the tubes were placed in BD BACTEC MGIT. The sensitive or resistant outcome from the instrument were recorded and estimated for the growth rates and minimum inhibitory concentrations for the oil and Bedaquiline as described by Jayapal et al.32
Data analysis – The significance of age demography and Mtbc drug resistance pattern was determined using ANOVA, taking p values at < 0.01 and 0.05. Eta-square was calculated as a descriptive measure of the strength of association between phytochemical compounds (independent) and the antimicrobial activities of OsEO (dependent), and further interpreted for Pearson's coefficient, taking the significance at p < 0.05. The concentrations of OsEO that inhibit 50% (IC50) and 90% (IC90) test isolates were determined by the graphical method as described by Huber and Koella.33 The significance of the prevalent MDR-Mtbc and resistance patterns were determined using Kruskal-Wallis Rank Sum and ANOVA in SPSS v20 and GraphPad prism. Principal component analysis (PCA) was performed using PAST 4.03 to evaluate the biplot ordination and association of phytochemical compounds and GC chemotypes with the oil antimycobacteria activity while Eigenvalues > 1.00 were accounted for the number of selected components as described by Kaiser criterion.34
From sputum of clinically diagnosed TB patients of different age groups (n = 546), Gene Xpert identified Mtb positive cases among the adults (61.3%), and youth (22.6%), while low rates were recorded among the children (12.9%), and elderly (3.2%) (Fig. 1A). Drug resistance pattern showed more than 50% Mtb strains resistance to rifampicin, and isoniazid (Fig. 1B); significant proportion rates of RR (50%), and MDR (40.2%), were observed (p < 0.05, Fig. 1C). Of the drug resistance Mtb strains, pre-XDR (2%), and MDR (36%), including rif/inh (24%), rif/inh/proth (7%), and rif/inh/ofx (5%), were noted (Fig. 1D).
The 16S-sequenced MDR-Mtb strains, which have a rifampicin, isoniazid, and ofloxacin resistance pattern and are also common among all age groups, were selected for phylogenetic diversity evaluation. All the MDR-Mtb strains clustered differently with globally distributed strains from human populations. The genetic relatedness of Nigerian MDR-Mtb strains with reported strains from other countries further reveals distinct clusters or groups of closely related strains that predominate in other regions. Having the strains grouped together in clusters 5, 6, and 8 indicates an unrelated strain population with a similar drug resistance pattern among the patients with a clear independent genetic composition (Fig. 2).
In Table 1, OsEO showed higher growth unit reduction (48.90 GU) compared to the control agent, Bedaquiline (46.80 GU), against the MDR-Mtb and ATCC 27294 strains, suggesting a significant inhibitory activity of OsEO against the MDR-Mtb, while higher inhibitory activity was observed against H37Rv compared to Bedaquiline. OsEO provided significantly higher inhibitory activity against MDR-Mtb at IC50 compared to Bedaquiline (p = 0.002, Fig. 3A), while significantly higher inhibition of Bedaquiline at IC90 was observed with OsEO (p = 0.001, Fig. 3B). The estimation of phytochemical parameters revealed a significant level of alkaloids and flavonoids (Fig. 3C), with a significant association of phytochemical compounds with anti-MTB activity (eta = 0.5245; p = 0.002).
| Agents (GUR) | MDR-Mtb (n = 13) |
H37Rv (n = 2) |
ATCC 27294 (n = 2) |
f value | p value |
|---|---|---|---|---|---|
| (x̄ ±SE) | |||||
| OsEO | 48.90 ± 5.40a | 15.00 ± 5.00d | 22.00 ± 6.00b | 5.377 | 0.024 |
| Bedaquinine | 46.80 ± 6.78a | 35.00 ± 5.00e | 25.00 ± 5.00b | 1.176 | 0.030 |
| DMSO | 4552.00 ± 177.74c | 4100.00 ± 100.00f | 4750.00 ± 150.00c | 0.889 | 0.440 |
Following the GC-MS analysis of the OsEO, a high percent content of methanoazulene (14.15%), benzodioxole-5-carboxylic acid (10.61%), and 2-hydroxybenzylideneamino (8.30%) with reported associated antimycobacterial and antibacterial activities16,18 was observed (Table S3) and graphically presented in a chromatogram as % concentration in Fig S1. A very low percentage composition of less than 4% was observed in the levels of cyclohexane, propanamide, cyclohexene, tetrahydro-thiazolo, phenol, 3(2H)-benzofuranone, 9(2H)-and acridone (Table 2). The antimycobacterial inhibitory activity of OsEO phytochemical compounds against the MDR-Mtb pathogens exhibited significant inhibitory activity with principal components 1 and 2 (Fig. 1). This implies that the level of phytochemical compounds in OsEO has inhibitory antimycobacterial activity (Fig. 4A). PCA further revealed PC 84.5% variation, suggesting a significant association of chemotypes (including cyclohexane, carbonic acid, cholesta-6,22,24-triene, palmitoleic acid, cyclododecanemethanol, propanamide, mercaptoethanol, and tetrahydro-thiazolo) with the susceptibility of MDR MTB (Fig. 4B).
| Compound | Rt | Area % | Ref |
|---|---|---|---|
| Cyclohexane | 28.951 | 4.33 | |
| Carbonic acid | 27.360 | 5.22 | |
| Cholesta-6,22,24-triene | 26.593 | 5.82 | |
| Palmitoleic acid | 26.101 | 4.61 | |
| Cyclododecanemethanol | 25.266 | 5.63 | |
| Propanamide | 24.848 | 3.92 | |
| Mercaptoethanol | 24.110 | 6.14 | 16,17,51,55 |
| 2-Hydroxybenzeneacetic acid | 23.921 | 5.81 | |
| cyclohexene | 23.234 | 3.29 | |
| tetrahydro-thiazolo | 20.310 | 3.72 | |
| benzodioxole-5-carboxylic acid | 15.029 | 10.61 | |
| Methanoazulene | 14.176 | 14.15 | |
| Diethyl methylphosphonite | 12.586 | 7.33 | |
| Phenol | 9.009 | 3.85 | |
| 2-hydroxybenzylideneamino | 8.225 | 8.30 | |
| 3(2H)-Benzofuranone | 8.151 | 3.50 | |
| 9(2H)-acridone | 3.173 | 3.76 |
The present study was set to elucidate the antimycobacterial potential of OseEO and to identify chemotypes with significant antibacterial efficacy. Looking at the rate of MTb infection based on the age demographics of the patients, it was found that a significant proportion of adults and adolescents were infected. Interestingly, the most of the recovered strains were detected among the economically productive age group although the data on their socioeconomic circumstances remains to be elucidated. This observation was similarly reported in Nigeria,35 in pulmonary tuberculosis patients in Jigjiga town in Ethiopia36 and in the Zambian population.37 The impact of age demographics also shows the populations having a high burden of disease because of the widespread use of antibiotics to manage bacterial lung infections other than TB.38 The observed high rates of Mtb infection in the population of this age group are evidence of active mobility for socioeconomic improvement, which could enable spread within and between communities.4 Other factors such as uncontrolled antibiotic use, alcohol consumption, smoking, unprotected sexual behavior, unemployment, and poor access to health facilities could influence infection rates, especially among young adults.39
Surprisingly, a high proportion of drug resistance was observed among new cases (primary infection), suggesting misuse of anti-TB or adulterated drugs. The observed resistance to first-line anti-TB drugs (i.e. rifampicin and isoniazid), and poor susceptibility to ofloxacin (flouroquinolone-FQ) in the population calls for urgent and strategic population-based surveillance with practical control of FQ use in pulmonary infections. The shift towards pre-XDR due to FQ resistance mutations with or without other anti-TB drugs conditions persistent pulmonary morbidity.40 The predominant FQ mutation mediated by the reported gyrA D94G and gyrA A90V contributes to widespread high-level resistance,41,42 which could complicate the control and treatment of TB.
The determined genetic relatedness of selected MDR-Mtb (with a common drug-resistant pattern) to other globally characterized strains reveals single strain populations belonging to diverse clusters, suggesting possible micro-evolution among individual patients leading to clonal subpopulations with similar genetic structure.43 Due to the small number of MDR-Mtb strains to illustrate clonal diversity, more strains would be required to verify human-to-human transmission, which could trigger genetic drift under selection pressure of anti-TB drugs, promoting sequential acquisition of drug resistance in patients undergoing long-term treatment.43,44 The widespread and poor use of antibiotics in the treatment of pulmonary MTb has led to continuous emergence of drug-resistant strains (mostly MDR-MTb), necessitating a prolongation of drug therapy with the associated negative consequences.
Once the occurrence of clonally distinct MDR-Mtb has been established, the choice of definitive therapeutic treatment could be complicated by unsuccessful therapeutic outcomes.45 The observed clonally different resistance strains necessitate the search for a natural antimicrobial product such as OsEO with known phytochemical composition and synergistic antimicrobial activities.16 The observed inhibitory activity of OsEO against MDR-Mtb was attributed to a significant estimated content of alkaloid and flavonoids16 The combined activity of flavonoids and alkaloids makes the anti-mycobacteria activity of OsEO much more significant. Flavonoids and alkaloids are an important group of antioxidants that adequately scavenge reactive oxygen species such as hydroxyl radicals and superoxide anions which cause oxidative stress and lead to cytotoxic damage, by eliminating "oxygen free radicals", resulting in a relatively "stable radical". Free radicals (are metastable chemical species) that capture electrons from molecules in the cytosol, leading to poor cellular metabolism in bacteria.46,47 Alkaloids was reported to act as DNA intercalating agents which disrupt DNA replication,48 while flavonoids and phenol impact adverse activities on hydrogen bonding, protein, and some microbial enzymes metabolism leading to inhibition of cell replication and cytosol metabolic activities.48,49 With regard to the anti-mycobacterial activity of OsEO phytochemical compounds, the volatile metabolites (chemotypes) analysed at GC-MS showed a significant predictive anti-mycobacterial activity of methanoaculene, benzodioxole-5-carboxylic acid, and 2-hydroxybenzylideneamino (Table S3).
Methanoazulene is a derivative of azulene belonging to a large family of terpenes50,51 known for disrupting and penetrating the lipid structure of the bacteria cell, causing the cellular proteins denaturation, cytoplasmic leakage, and eventual cell death.52 On the other hand, the synergistic activity of benzodioxole-5-carboxylic acid was reported to affect cell metabolic functional and signal pathways, which modulate cellular processes including cell proliferation, apoptosis, and immune response.52 The constituents of phenol in essential oil bind to dihydrofolate reductase enzymes from bacterial, causing inactivation of the supercoiling process of bacterial gyrase and also to the ATP binding site of bacteria gyrase B and DNA, thereby enhancing topoisomerase IV enzyme-mediated DNA cleavage, resulting in bacterial replication stasis and poor synthesis of plasmid DNA53 Generally, most of the listed chemotypes in Ocimum santum essential oil cause changes in the structural and functional activities that disrupt cellular functions from the outer to inner cytoplasmic membrane, proteins, and intracellular targets; to cellular fluidity.16 It was reported that these chemotypes are non-toxic, like first-line antituberculosis drugs (isoniazid, rifampicin, and pyrazinamide).54 These attributes make these chemotypes suitable natural antimycobacterial compounds with high potential for the development of lead antimycobacterial compounds.55 The presence of diverse chemotypes that are strongly correlated with antimycobacterial activity suggests OsEO as a novel natural product that is a less expensive and non-toxic56 alternative antimycobacterial agent for genetically diverse MDR-Mtb.
In conclusion, clonally diverse MDR Mycobacterium tuberculosis observed among the populace tends to limit the therapeutic function of present anti-tuberculosis drugs, thereby increasing the pulmonary morbidity among the infected individuals. Different clustering groups further inform the potential evolution of these strains towards the emergence and dissemination of drug-resistant strains of M. tuberculosis that can present another challenge for curbing TB. Therefore, different chemotypes contained in OsEO are promising antimycobacterial substances for developing anti-TB drug candidates with synergistic potential on target cellular processes and the chances of being utilized and developed as analogues or derivatives of existing drugs.
The authors appreciate the management of Federal Medical Centre, Abeokuta for assisting the collection of data, and Akinyosoye A. for his technical assistance.
The authors declare that they have no competing interests.
| 1. | World Health Organization. Global tuberculosis report 2020, WHO, Geneva. |
| 2. | Matteelli, A.; Rendon, A.; Tiberi, S.; Al-Abri, S.; Voniatis, C.; Carvalho, A. C. C.; Centis, R.; D’Ambrosio, L.; Visca, D.; Spanevello, A.; Migliori, G. B. Eur. Respir. Rev. 2018, 27, 180035.![]() |
| 3. | Gill, C. M.; Dolan, L.; Piggott, L. M.; McLaughlin, A. M. Breathe 2022, 18, 210149.![]() |
| 4. | Chakaya, J.; Khan, M.; Ntoumi, F.; Aklillu, E.; Fatima, R.; Mwaba, P.; Kapata, N.; Mfinanga, S.; Hasnain, S. E.; Katoto, P. D. M. C.; Bulabula, A. N. H.; Sam-Agudu, N. A.; Nachega, J. B.; Tiberi, S.; McHugh, T. D.; Abubakar, I.; Zumla, A. Int. J. Infect. Dis. 2021, 113, S7–S12.![]() |
| 5. | Fukunaga, R.; Glaziou, P.; Harris, J. B.; Date, A.; Floyd, K.; Kasaeva, T. MMWR Morb. Mortal. Wkly. Rep. 2021, 70, 427–430.![]() |
| 6. | Ugwu, K. O.; Agbo, M. C.; Ezeonu, I. M. Afr. J. Infect. Dis. 2021, 15, 24–30.![]() |
| 7. | Gidado, M.; Mitchell, E. M. H.; Adejumo, A. O.; Levy, J.; Emperor, O.; Lawson, A.; Chukwueme, N.; Abdur-Razak, H.; Idris, A.; Adebowale, A. Public Health Action 2022, 12, 115–120.![]() |
| 8. | Ogbo, F. A.; Ogeleka, P.; Okoro, A.; Olusanya, B. O.; Olusanya, J.; Ifegwu, I. K.; Awoseme, A. O.; Eastwood, J.; Page, A. Trop. Med. Health 2018, 46, 34.![]() |
| 9. | Zenteno-Cuevas, R. Microbes Infect. Chemother. 2022, 2, 1318–1318.![]() |
| 10. | Sulis, G.; Sayood, S.; Gandra, S. Expert Rev. Anti Infect. Ther. 2022, 20, 147–160.![]() |
| 11. | Zhou, Z.; Yi, H.; Zhou, Q.; Wang, L.; Zhu, Y.; Wang, W.; Xiong, H. BMC Genomics 2023, 24, 241.![]() |
| 12. | Alara, J. A.; Alara, O. R. Infect. Disord. Drug Targets 2024, 24, e250723219043.![]() |
| 13. | Akinduti, P. A.; Osiyemi, J. A.; Banjo, T. T.; Ejilude, O.; El-Ashker, M.; Adeyemi, A. G.; Obafemi, Y. D.; Isibor, P. O. PLoS One 2021, 16, e0247013.![]() |
| 14. | Gautam, S. S.; Mac Aogáin, M.; Cooley, L. A.; Haug, G.; Fyfe, J. A.; Globan, M.; O’Toole, R. F. PLoS One 2018, 13, e0192351.![]() |
| 15. | Inanoglu, S.; Goksen, G.; Nayik, G. A.; Nejad, A. S. M. In Essential Oils; Academic Press: Cambridge, MA, 2023, pp 309–324.![]() |
| 16. | Eid, A. M.; Jaradat, N.; Shraim, N.; Hawash, M.; Issa, L.; Shakhsher, M.; Hanbali, A.; Barahmeh, N.; Taha, B.; Mousa, A. BMC Complement. Med. Ther. 2023, 23, 221.![]() |
| 17. | Saharkhiz, M. J.; Kamyab, A. A.; Kazerani, N. K.; Zomorodian, K.; Pakshir, K.; Rahimi, M. J. Jundishapur J. Microbiol. 2015, 8, e13720.![]() |
| 18. | Tomar, H.; Rawat, A.; Nagarkoti, K.; Prakash, O.; Kumar, R.; Srivastava, R. M.; Rawat, S.; Rawat, D. S. S. Afr. J. Bot. 2023, 157, 360–371.![]() |
| 19. | Wondale, B.; Medhin, G.; Abebe, G.; Tolosa, S.; Mohammed, T.; Teklu, T.; Pieper, R.; Ameni, G. Infect. Drug Resist. 2018, 11, 1581–1589.![]() |
| 20. | Bateson, A.; Canseco, J. O.; McHugh, T. D.; Witney, A. A.; Feuerriegel, S.; Merker, M.; Kohl, T. A.; Utpatel, C.; Niemann, S.; Andres, S.; Kranzer, K.; Maurer, F. P.; Ghodousi, A.; Borroni, E.; Cirillo, D. M.; Wijkander, M.; Toro, J. C.; Groenheit, R.; Werngren, J.; Machado, D.; Viveiros, M.; Warren, R. M.; Sirgel, F.; Dippenaar, A.; Köser, C. U.; Sun, E.; Timm, J. J. Antimicrob. Chemother. 2022, 77, 1685–1693.![]() |
| 21. | Mchaki, B. R.; Mgaya, F. X.; Kunambi, P. P.; Hang’ombe, B.; Matee, M. I.; Munyeme, M. Antibiotics 2022, 11, 1489.![]() |
| 22. | Rendon, A.; Tiberi, S.; Scardigli, A.; D’Ambrosio, L.; Centis, R.; Caminero, J. A.; Migliori, G. B. J. Thorac. Dis. 2016, 8, 2666–2671.![]() |
| 23. | Mon, A. S.; Ei, P. W.; Htwe, M. M.; Nyunt, M. H.; Win, S. M.; Nyunt, W. W.; Myint, Z.; Aung, W. W. Antimicrob. Agents Chemother. 2022, 66, e0092522.![]() |
| 24. | Mayunga, E.; Kusolwa, P.; Chilagane, L. J. Curr. Opin. Crop. Sci. 2023, 4, 13–24.![]() |
| 25. | Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. Mol. Biol. Evol. 2018, 35, 1547–1549.![]() |
| 26. | De Maio, N.; Kalaghatgi, P.; Turakhia, Y.; Corbett-Detig, R.; Minh, B. Q.; Goldman, N. Nat. Genet. 2023, 55, 746–752.![]() |
| 27. | Ajuru, M. G.; Williams, L. F.; Ajuru, G. J. Food Nutr. Sci. 2017, 5, 198–205.![]() |
| 28. | Abbas, A.; Anwar, F.; Ahmad, N. J. Essent. Oil Bear. Plants. 2017, 20, 95–109.![]() |
| 29. | Soladoye, M. O.; Chukwuma, E. C. Phytol. Balcan. 2012, 18, 149–153. |
| 30. | Bhargava, S.; Madhav, N. V. S. Data Brief 2018, 21, 996–1003.![]() |
| 31. | Mohammed, A. M. A.; Alrayeh, A. S.; Mohamed, M. E.; Abdel-Rahman, N. A. Bull. Natl. Res. Cent. 2021, 45, 214.![]() |
| 32. | Jayapal, V.; Raj, C. K. V.; Muthaiah, M.; Chadha, V. K.; Brammacharry, U.; Selvaraj, S.; Easow, J. M. Indian J. Tuberc. 2021, 68, 470–473.![]() |
| 33. | Sahu, A.; Nayak, G.; Bhuyan, S. K.; Bhuyan, R.; Kar, D.; Kuanar, A. Multidiscip. Sci. J. 2024, 6, e2024026.![]() |
| 34. | Loewen, S.; Gonulal, T. In Advancing Quantitative Methods in Second Language Research; Plonsky, L. Ed.; Routledge: New York, 2015; pp 182–212.![]() |
| 35. | Nyosoye, A. D.; Oniha, M. I.; Oduselu, T. J.; Akinbo, J. A.; Akinduti, P. In Biotechnological Approaches to Sustainable Development Goals; Isibor, P. O.; Akinduti, P.; Oranusi, S. U.; Popoola, J. O. Eds.; Springer: Cham, 2023; pp 205–214. |
| 36. | Brhane, M.; Kebede, A.; Petros, Y. Infect. Drug Resist. 2017, 10, 75–83.![]() |
| 37. | Chanda-Kapata, P.; Kapata, N.; Klinkenberg, E.; Grobusch, M. P.; Cobelens, F. BMC Infect. Dis. 2017, 17, 236.![]() |
| 38. | Oladimeji, O.; Othman, Y.; Oladimeji, K. E.; Atiba, B. P.; Adepoju, V. A.; Odugbemi, B. A. Microbiol. Res. 2022, 13, 609–619.![]() |
| 39. | Lönnroth, K.; Castro, K. G.; Chakaya, J. M.; Chauhan, L. S.; Floyd, K.; Glaziou, P.; Raviglione, M. C. Lancet 2010, 375, 1814–1829.![]() |
| 40. | World Health Organization. Meeting report of the WHO expert consultation on the definition of extensively drug resistant tuberculosis 2021. Geneva: WHO. |
| 41. | Dheda, K.; Gumbo, T.; Maartens, G.; Dooley, K. E.; Murray, M.; Furin, J.; Nardell, E. A.; Warren, R. M. Lancet Respir. Med. 2019, 7, 820–826.![]() |
| 42. | World Health Organization. Catalogue of mutations in Mycobacterium tuberculosis complex and their association with drug resistance 2021. Geneva: WHO. |
| 43. | Niemann, S.; Merker, M.; Kohl, T.; Supply, P. Microbiol. Spectrum 2016, 4, 1–18.![]() |
| 44. | Roetzer, A.; Diel, R.; Kohl, T. A.; Rückert, C.; Nübel, U.; Blom, J.; Wirth, T.; Jaenicke, S.; Schuback, S.; Rüsch-Gerdes, S.; Supply, P.; Kalinowski, J.; Niemann, S. PLoS Med. 2013, 10, e1001387.![]() |
| 45. | Niemann, S.; Richter, E.; Rüsch-Gerdes, S.; Schlaak, M.; Greinert, U. Emerg. Infect. Dis. 2000, 6, 548–551.![]() |
| 46. | Akinduti, P. A.; Emoh-Robinson, V.; Obamoh-Triumphant, H. F.; Obafemi, Y. D.; Banjo, T. T. BMC Complement. Med. Ther. 2022, 22, 47.![]() |
| 47. | Omojate, G. C.; Enwa, F. O.; Jewo, A. O.; Eze, C. O. J. Pharm. Chem. Biol. Sci. 2014, 2, 77–85. |
| 48. | Pfoze, N. L.; Kumar, Y.; Myrboh, B.; Bhagobaty, R. K.; Joshi, S. R. J. Med. Plants Res. 2011, 5, 859–861. |
| 49. | Saravanakumar, A.; Venkateshwaran, K.; Vanitha, J.; Ganesh, M.; Vasudevan, M.; Sivakumar, T. Pak. J. Pharm. Sci. 2009, 22, 282–286. |
| 50. | Thakur, M.; Melzig, M. F.; Fuchs, H.; Weng, A. Botanics. Targets Ther. 2011, 21, 19–29. |
| 51. | Bakun, P.; Czarczynska-Goslinska, B.; Goslinski, T.; Lijewski, S. Med. Chem. Res. 2021, 30, 834–846.![]() |
| 52. | Rather, M. A.; Lone, A. M.; Teli, B.; Bhat, Z. S.; Singh, P.; Maqbool, M.; Shairgojray, B. A.; Dar, M. J.; Amin, S.; Yousuf, S. K.; Bhat, B. A.; Ahmad, Z. Med. Chem. Commun. 2017, 8, 2133–2141.![]() |
| 53. | Er, Y.; Sivri, N.; Mirik, M. Bacteriol. J. 2018, 8, 1–11.![]() |
| 54. | Siddiqa, A.; Rehman, A.; Abbasi, M. A.; Rasool, S.; Khan, K. M.; Ahmad, I.; Afzal, S. Trop. J. Pharm. Res. 2014, 13, 1689–1696.![]() |
| 55. | Akinduti, P. A.; Osunlola, O. L.; Adebekun, F. A.; Viavonu, D. T.; Elughi, G. N.; Popoola, O.; Abdulsalami, S. A. Med. Microecol. 2024, 22, 100115.![]() |
| 56. | Ugboko, H. U.; Nwinyi, O. C.; Oranusi, S. U.; Fatoki, T. H.; Akinduti, P. A.; Enibukun, J. M. Bioinform. Biol. Insights 2019, 13, 1177932219884297.![]() |
| 57. | Bano, N.; Ahmed, A.; Tanveer, M.; Khan, G. M.; Ansari, M. T. J. Bioequiv. Availab. 2017, 9, 387–392. |